Last active:
SpaceHey Blog URL:
https://blog.spacehey.com/cyberanakinvader
— 4 KudosPinned
Category: News and Politics
It is a seismic shock to me and all around the world that multiple brutal terroristic incursions and attacks against local and international civilians in Israel had unfolded on 10/7, a day which will live in infamy as 9/11 and 12/7. » Continue Reading
— 2 Kudos
Category: News and Politics
As of March 2023, here are the post-wa » Continue Reading
Category: Life
I have to tell you a terrible truth that I have been officially diagnosed with COVID-19. https://cyberanakinvader.wordpress.com/2022/02/27/i-have-to-tell-you-a-terrible-truth-that-i-have-been-officially-diagnosed-with-covid-19/ » Continue Reading
Category: Life
By today, I'm very pleased to tell you all that I have fully vaccinated with two AZ shots. » Continue Reading
Category: News and Politics
I am declaring the intention of non-recognition of the re-established Taliban regime in Afghanistan, due to reasons such as disapproval of their extremely-retrograde policies with regards to religious minorities, historical artifacts and chief among all, the female population. I want to emphasise that the Taliban of the present and the Taliban of the past (1996-2001) are not discernable between ea... » Continue Reading
Category: Life
By today, I'm very pleased to tell you all that I have been vaccinated with the AZ vaccine, even though it's just the first shot. » Continue Reading
Category: Life
It is with pleasure to say that I have finally obtained a spot for COVID-19 vaccination in late-June/early July period. May the force be with you, alwa » Continue Reading
Category: Web, HTML, Tech
Inserted LEAPER gRNA sequence: CTTTAAAGAACAAAAGAACCCTTAGTAGTGTTGACACCGACGTAAAGTGGTTCTTACACCAAATGTCAGT » Continue Reading
Report User
